Homepage » Acting (on) the Text: the Case of New Media (6. 2014) » Tatiani Rapatzikou

Issue 6

[.pdf]

Language Amplifications and Visualisations in
Michael Joyce’s was and Alexandra Grant’s babel

 

Tatiani G. Rapatzikou

          Abstract 

This article focuses on Michael Joyce’s novel was and Alexandra Grant’s painting babel in an attempt to explore what changes  occur when moving between media, language codes and materials. Grant’s painting is a response to Joyce’s print-bound novel. Her work serves as a remediation as well as a reconceptualisation of Joyce’s textual endeavor. In examining these works, we can locate a dynamic relation across the patterns of visual and verbal communication that they create. Joyce’s and Grant’s collaboration breaks new ground not only in terms of understanding how different media function but also by introducing an experiential and participatory form of narrative development. Through their engagement with different media, these works create narratives that are visually, verbally, spatially and conceptually challenging. 

In Michael Joyce’s novel was: annals nomadique, a novel of internet, and Alexandra Grant’s babel painting, which resonates from Joyce’s text, create a multi-sensory and multi-linguistic spatial experience. Both pieces, the print-bound text and the painting, were produced almost consecutively in 2006 and were the outcome of a collaborative endeavour between the author and the visual artist. It should be noted though that was is not an ordinary print text, but an elaboration on the “fleetingness of information” (jacket blurb), as this results from our everyday interactions and engagement with various modes and mediums of communication, including digital technologies.

Dave Ciccoricco, in his online review about was, writes that “Fleetingness plays a leading role indeed, while digital information technology is a vital support, mostly silent but ever-present.” As for Grant’s babel painting, it is a mixed media project that focuses on the processes at work when information constantly recasts and appropriates itself as it moves through various visual, verbal and spatial modes of expression.[ 1] In both cases, Joyce’s and Grant’s works use familiar materials, techniques and forms–the material page, the painted canvas, and the printed or handwritten text–so as to sensitise us towards the interconnections and interrelations that can emerge as we move through and shift between languages, codes and mediums of expression. For the purpose of this paper, the interconnectedness that is established between Joyce’s and Grant’s works serves as an example of how stories can be transferred beyond the confines of a single medium or authorship for the creation of a spatially and conceptually enhanced field of information and experiences. It is the movement across or transition between Joyce’s and Grant’s pieces that sheds light on the different processes at work as information moves, repurposes and remediates itself. 

Joyce, in his book entitled Of Two Minds: Hypertext Pedagogy and Poetics written in 1996, a period during which the Web takes its first steps, claims that “[w]e are [now] able to sense how many nested, transparent surfaces construct the apparently singular mirror. We are able to map the multiple and interstitial contours of discourse” (66). With these words, Joyce, quite early on, highlights the significance of acknowledging the interactive and interlacing relationships that can develop as to how various pieces of information can travel from context to context, and how a medium can affect our communication habits and practices. This enables us to realise how everything is embedded or enfolded within one another and how everything can transform or be appropriated into something else by rendering all previous processes or media used invisible. In the case of Joyce’s was and Grant’s babel, various mediums are at work. This process brings to the fore the multiple transformations that stories, characters, voices and languages can undergo. In turn, this can lead to a far more enhanced array of temporal, spatial and linguistic intertwinings. 

In Joyce’s case, this constitutes an essential element of his artistic practice. In particular, his innovative CD-ROM-based hypertext entitled afternoon, a story, published in 1987, introduces hypertextual writing, an electronic-based practice where various blocks of text (lexias, to borrow Roland Barthes’s term[2] can function as independent story blocks or can lead to other blocks, not necessarily in a sequential order, for the production of multiple and diverse non-linear narratives on the basis of how readers choose to move between them. This writing endeavour is followed by other works, as is the case of Joyce’s Twilight, a Symphony, a CD-ROM based hypertext published in 1996, Twelve Blue, a web hypertext also published in 1996; and Reach, a fiction published on the web in 2000. In relation to his print-bound works, for example Liam’s Going (2002) and Disappearance (2012), Joyce strives for an effect that draws from the hypertextual element of his online projects but with a twist, since attention is now paid to how the diversity and fluidity of his intersecting and haphazard stories is transferred to the print medium. In Grant’s case, emphasis is placed on the fleeting sensation created both visually and materially when in her painted projects she tries to combine elements and information that emerge from various mediums. In her 2008 interview for Modern Edition, she claims that “taking an idea from one medium to another can open up new ways of thinking” (“A Way with Words”). This is evident in a number of her artistic projects. For the installation project REACH in 2003, she mediates Joyce’s synonymous hypertextual narrative into an installation that combines wire, coloured pencil and lead with a paper background; her suspended NIMBUS installations in 2004, transform Joyce’s NIMBUS poems into motor-generated, kinetic objects made out of wire-words whose shadows, due to an overhead lamp, are cast around the exhibition space. Grant has consistently experimented with medium embeddedness and appropriation as this is evidenced into her collaborative projects with other artists. What characterises Joyce’s and Grant’s practice is the fluid sensation of the informational flow triggered by the ongoing enfoldings and transformations the various elements of their works, or the materials their works are made out of, undergo. 

In was, it is this constant movement from story to story, language to language and scene to scene without following any coherent narrative pattern, that Joyce both exposes and explores. This kind of writing certainly challenges the way one looks at printed narrative:  it is not only the storyline that matters but also the way this is laid out on the page, which contributes to and amplifies the multi-layering and spatial effect his narrative creates. Attention is shifted from what is narrated to the mechanisms employed for amassing and then synthesising all these verbal pieces of information, raising one’s awareness as to what can be inscribed and infused into a printed text when this is seen not in isolation but in conjunction with other media. Perhaps this is where Joyce’s experimentation with hypertext infiltrates in was, and specifically in its labyrinthine and often disjointed storylines that challenge readers to find their own point of entry into the information that flows onto the page, making this book  at times impenetrable but offering nonetheless a subversive reading experience. Thomas Hove’s comment in his review of Joyce’s was responds to this particular feeling, when he writes that it conveys “the constant nomadicity and ‘global creolization that characterise the experience of websurfing” (221), in an effort to reveal its non-static, ever-expanding and hybridised nature when seen not in an exclusively digital but in a much more expansive context. Even the tripartite title of the novel is suggestive of this process of ongoing reconfiguring and intermingling of various sensations, temporalities, methods of inscribing and recording experience, as suggested by the words was, annals, nomadique and internet. It is this sense of interminable movement and contextual lapses that point beyond any hierarchical distinctions or marked events and actions. Joyce describes this in Othermindedness as “the feeling that we are elsewhere, on another terrain” (161), with the narrative in was shifting and twisting between words, blocks of texts, languages, locations, names, and events. This is what Joyce describes as “a layering of discourses…an enfolded project” (Personal Interview), in an effort to make us aware of the co-existence, irregularity, the subtle encasings and constant transitions of everyday experiences and communication practices. 

A similar feeling is evident in Grant’s twenty-two-feet-long babel painting, created in 2006 after the publication of Joyce’s was. What it actually appropriates in its two variously depicted word-bubble slopes and the white space in between, is the experience that Joyce’s text emanates. Grant’s babel testifies her allegiance to the process of re-mediation and its capacity to endow the painted canvas with linguistic and textual elements as these are transferred to it from another medium, that of Joyce’s printed text. However, Grant does not simply replicate the effect of Joyce’s novel but moves on with the construction of a material and tactile textual painting that constitutes an alternative take on Joyce’s was, making readers/viewers aware of the materials and the inscription practices employed for the infiltration of media or language-specific information into her painterly process. The artist has commented on the first stages of her endeavour and the transition from Joyce’s was to her own painting:

With was there were several parameters for the piece. The book as score or script. The shape of the piece–a horizon–and the largest painting I’d ever made. I was very conscious of the fact that the painting needed a foreground, middle and background…The next was that the words would be urban or metropolitan–some are literally billboards on buildings.  Once I’d decided on these compositional parameters or rules, I simply began writing the text, and it began to take its own form.[…I wanted it to look like a city sounds, if that makes sense, with honking and traffic overlapping a conversation with the radio playing too. In the same way that Michael’s was reads like an experience of the city rather than a description. (Grant, “RE- Presentation”)

Grant focuses here on the process of capturing and visualising Joyce’s was as multiple layers of information and experiences that would gradually lead to the construction of her own babel landscape. Certainly, her conceptualisation derives from her understanding of Joyce’s was not as a mere flat, book-bound, two-dimensional narration but as a fluid and redirectional textual space where words turn into sounds, sounds into live speech, and speech into sentence clusters which in turn she sees in her mind’s eye as a series of spatially expansive and intersecting word bubbles. Also, the title that Grant chooses, babel, highlights as well as retains the initial feel of Joyce’s textual experiment, which she brings into her own artistic practice: that of an initial informational density and confusion. This gradually compels the reader/viewer to look at her work as a verbal, visual and spatial terrain that constantly expands, allowing for different discourses, images or even mapping patterns to emerge. Interested in the accentuation of the visual aspects of everyday verbal communication and in the technologically-generated stimuli that surround us, Grant conceptualises Joyce’s was as a closely-packed urban environment whose diverse media and intense sense impressions —billboards, traffic horns and honking, radio, live speech, language switching— coalesce in a visually vivid manner. This combined with the immense size of the babel painting, the whole painterly experience is transformed into a visually challenging but immersive field of action. This is attributed to the inverted perspective Grant introduces with the backward placement of words on the canvas, deepening its absorbing spatial effect, since the language inscribed on its surface is no longer inhibited by semantic constraints but opens up to other visualisations and paths of communication. This transforms language into an energetic, non-verbal code of intersecting colours, shapes and lines that amplify the feeling of unfamiliarity, as the work abandons semantic clarity. This is enabled by Grant’s own conceptual execution of the interweaving and juxtaposed sensations that Joyce’s was emanates.

The interlocking narratives in was bring to mind Joyce’s comment in Of Two Minds where he talks about “the creation of an intricately networked novel-as-knowledge-structure that both simultaneously invites and confirms reader interaction” (138), with the notion of the network taken here to stand for the channels of communication and augmented information planes its informational structures create. In was, this is quite apparent if one takes into consideration the density and plethora of information it contains, as will be mentioned further down. Alexander R. Galloway in his definition of “Networks” argues that “networks are understood as systems of interconnectivity,” (283) in order to place emphasis not on the homogeneity of the knowledge accumulated or the circulation of information but on diversity due to constant rerouting and reorganisation. Certainly, if we add the human factor, since Joyce talks, as mentioned earlier, about “reader interaction” (Of Two Minds 138), we come to view networks of information not as mere abstractions but as landscapes that can constantly expand and alternate due to the input readers provide as they move or cruise through them. This makes the reading and interpretative experience in itself even more compelling since the text does not strive towards being readable but on generating different ways of conceptualising language and communication. As Ciccoricco says: “[u]ltimately what resides in Joyce’s was are meditations —residual as they may— be on the foreign and the familiar and, more specifically, how the relationship between them is recast in network culture.” Certainly, with his reference to network culture he touches upon the constant flow, branching out and reconceptualisation of information that was deals with and not with the mere engagement of “global creolization=URL” with digital technologies, as has already been mentioned. This brings to mind Joyce’s declaration in 2004 —just two years before the publication of was— where he claims that:

in recent years my artistic work has moved away from the field of electronic (hypertextual) literature out of concern for,…the current state of such work in which the image has…taken ascendancy over the word.…what brought me to computers and new media in the first place was my writing. (Marino) 

THis the kind of scepticism Joyce indirectly shares with us in was as he does not deal with digital technologies per se and the special effects they can generate, but with how a medium can influence or even engineer the way we decode and decipher in addition to how we perceive information, as this comes to us in various combinations, languages and styles that we have not encountered before. As a result, language does not fade away but re-emerges in different forms and formats. 

These expansive interconnections and ongoing shifts bring to the fore the interweaving dynamics of verbal and visual communication, enabling us to appreciate how language can reorganise itself when it moves through and interacts with different mediums of expression. Characteristically, Jay David Bolter and Richard Grusin state that “no medium today, and certainly no single media event, seems to do its cultural work in isolation form other media” (15); and they add that the point is not to “erase or to render automatic the act of representation…but to reproduce the rich sensorium of human experience” (33). Therefore, the way one medium interacts with or is embedded into another, as it happens with Joyce’s was and Grant’s babel, can produce a much more gratifying, both verbal and visual, experience for the readers/viewers in addition to allowing for different reactions and approaches to be generated with regard to the information they display or interact with. This does not only challenge the way a medium works in tandem with another one, which may lead to the activation of an intermedial conversation between them. It can also  lead to a much more holistic understanding of the relationship between the two collaborating artists, the media and materials they use, their works and their readers/viewers, paving at the same time the path towards a participatory process of creative practice. In an interview to Chiara Giovando, Grant describes the process she and Joyce usually follow for their collaborations: “For many of the series I did with Michael [Joyce]…we discussed a theme and a format first. Then Michael would retreat to process and write, and then email me the text. Starting with his texts, I’d begin a series.” This ongoing process stems from her own desire, as she admits in the same interview, to work with “a writer or a text [she] admire[s].” In particular, she talks about “a commitment to an idea bigger than [her]self, and a commitment to make the text come alive.” This is evident when one puts was and babel side by side. These two works do not simply complement one another, but create a series of verbal conceptualisations that both mentally and visually challenge the readers/viewers with regard to the way these works treat language in addition to questioning and subverting its conventional structures or expectations. In both works anything can happen: sentences can break down, various formations and verbal clusters can emerge and gradually transform language from a readable code to a visual pattern.

An initial encounter with was creates the impression that what one sees are vignettes of stories that take place at different times and locations as well as segments or blocks of text in media res. This has to do with the print and fragmentary quality of the narrative that, although in terms of literary style it looks familiar, may also seem foreign and distant. The globally dispersed characters and locations in was–Poland, Mendoza, Mexico, Poughkeepsie in NY, Mombasa, Dubai, Jumeira, Paris, Calgary, Roanoke in Virginia, Prague Castle, Karlskrona in Sweden, Jerusalem, Sudan, Ljubljana, Finikounda in Greece–create an expansive terrain of temporal and spatial frames, each one providing a different point of entry into the multiple worlds the narrative creates, as well as multiple and generative surfaces of action. As for the punctuation marks that appear in the text, as is the case for example with the scarce fullstops and frequent commas, these certainly enhance the sense of fluidity and indeterminacy one experiences when moving from one block of text to the other. However, these blocks are not fragments of a yet to be found coherent whole or comprehensive plot but fragments of constantly evolving elsewheres, to use Joyce’s own term, as experienced in the examples below:  

or follow reindeer into Lapland (was 25)

1500 km National Road, No.3, cab of a Word of God truck driven by a local taquillero playing Christian hiphop, i.e., Gospel Gangstaz and KJ-52, jumping along the Patagonian coast, at the bottom of the world seabirds, cellphone useless hello hallo echo (was 27-28)

a decision, theatre du soleil a la Cartoucherie (Paris), to keep her body to herself a full year at a time, thence regularly assess her progress (was 31)

betrothed, Kira, a medical student in Sofia (was 32) 

In these textual blocks, each word is opening up to multiple perspectives or allusions. This kind of writing moves beyond any syntactical or semantic expectations, while it launches a far more globally dispersed network of information that also reveals the emergence of a globally dispersed and diverse network of readers/viewers. This brings to mind Philip Leonard’s comment about a kind of writing that:  

appears to escape the regional or local constraints that are imposed by the materiality of the printed book, to offer unrestricted opportunities for distribution,[…]communities of reading and interpretation now seem to be shaped by cultural codes that are formed around shared interests rather than physical proximity. (11-12)

As a result, was becomes the repository of multiple experiences patterned in blocks of text made out of single lines, emails, wikipedia entries, text messages in various languages, mathematical and computer code inscriptions. This is the feeling Joyce’s reference in wasto “global creolization=URL” (12) [3] creates as it elucidates the emergence of a different kind of textuality that relies on the surfacing of a new globally-diversified and medium-driven language. 

This mood of transience and globality is also apparent in the way Grant transforms Joyce’s language in was into a spatial marker for her own painterly project. The backward presentation of the words she uses, as has been previously mentioned, is further enhanced by their insertion into differently coloured bubbles, creating simultaneously an interlacing and overlapping spatial effect. This multi-coloured palimpsestic impression is juxtaposed with the interfering white space in the middle of the canvas that further accentuates the overflowing effect that the word bubbles generate. These act both as an empty space waiting to be filled and as an unidentifiable white terrain that pushes its black borderline against the coloured word bubbles as if trying to move them towards the edges of or even outside the canvas. Grant claims in an online interview that “[a] painting is a membrane that reflects back what the artist is feeling while painting. Language…is rational: in order to write, you have to think in words. So between the physical act of painting and the controlling aspects of writing down thoughts there is already a tension of representation” (Schad). Τhe production of paintings that can be looked at rather than read allows her to move beyond any verbal or visual distinctions by creating works that speak directly to our senses, suggesting a different kind of reading. Accordingly, the words on the canvas of Grant’s babel are not burdened by what they denote or connote but they are animated by their own physicality, as is suggested by the colours applied in conjunction with the drawing of the variously sized bubbles. Grant is also known for the use of an un-font “with no style, that [is]n’t loaded with cultural ideas…recognizable as writing that could be made by anyone–open…[b]ut it is also mirror writing” (Schad). This considered in relation to was allows us to appreciate how Grant’s own language code opens up the painting to various approaches and interpretations, multiple visualisations and voices, suturing all distinctions and contradictions while exploring the physicality of writing itself through multiple motifs and configurations. This brings to mind W. J. T. Mitchell’s views in Picture Theory (1994) where he says that “writing, in its physical, graphic form, is an inseparable suturing of the visual and the verbal, the ‘imagetext’ incarnate” (95). It is this inseparability of elements that opens up to the growth of composite forms that offer an insight not only into the mere heterogeneity of the information contained in an artwork, as is Grant’s babel, but also into the constant dis- and re-locating experience it can activate. This calls for an alternative way of responding and engaging with the material at hand.

This becomes evident in the following excerpt from was where each type of discourse suggests a different context and source of information, while giving vent to visual and verbal interplays that highlight the verbal and pictorial aspects of its textuality: 

IVF, GIFT, ZIFT, TET, TESE, PGD, ICSI

TAGCCTATAATACAAATTCCAACCCACCTCATCT
GGGGCTT

having come here (Conceive Clinic, PO Box 67, Dubai,
UAE, Tel: (9-14) yyy xxxx) too weary for a real world or
to sleep

CNN on large screen plasma TV, pearl divers (saffanah) view
of the universe

.source                            1..1888
                         /organism=”Homo sapiens”
                         /chromosome=”19”
                         / map=”19q12-q13.2”
                        / cell_type=”fibroblasts”
          gene       1..1888
                          /gene=”PEPD”

ftz spz dnc fkh hh eag (41-42)

In this example, the text transforms into a tapestry of verbal and visual patterns of interweaving discourses and language codes. Certainly this challenges any conventional conceptualisation as to what a print-bound text or a prose novel is. As the lines above testify, they serve as the background for a ceaseless but textually-driven intermedial geography. Following up from the excerpt above, one can argue that Joyce’s was sets in motion different layers of information and codes that require the activation of different reading mechanisms. This does not refer to the mere consumption of a text when printed on paper but to the stimulation of a much more enhanced appreciation as to how language actually works. In his book Of Two Minds, Joyce pays attention to the way “language [is] enacted and embodied and that the meanings and uses of words…are constructed in community rather than ROM” (66), pinpointing that there is nothing that should be keeping language and its inscription technologies apart as the latter is both affecting and is affected by the way words are delivered and morphed. The way regular words entwine with code takes us to the various processing stages of writing where fully formed words are presented side by side with algorithms or long strings of coded sequences. But the question remains as to how such passages should be treated: what happens when the familiar is presented side by side with the unfamiliar? Should code be treated as an encrypted language that hinders communication or sparks creative thinking? Is this where the literary quality of such writings reside, in their ability to take us beyond the obvious into the imaginary plane of language? One could argue that reading does not merely move across the surface of a text but carries forward the verbal and visual messages encased in the language it is composed of, embellishing in this manner the literary discourse with further qualities and nuances without keeping it confined to a particular context. Even in the case of descriptive passages, description in was does not necessarily contribute to a complete or meaningful narrative or text block, since each word participates in the construction of a conjoined effect or of variously-sized textual threads, as shown below: 

poets will not come again

invisible lattice of mist across the valley manna of information descending from satellites like tiny angels on parachutes, the smoke from the bonfires of razor sharp canes twining with incense of olive prunings, fireflies rising

we grow up many

but can’t we please just stop awhile and hear something all the way through
(was 127)

These textual lines all appearing on the same page in the exact sequencing as shown here should be read not as finite narratives but as suggestive prompts that altogether construct an inter- or tans-medial textual experience. Even though was does not deal directly with digital technologies, as has been argued throughout this paper, it does share with us its concern, according to Ciccoricco, about “how the digital apparatus is transforming our everyday relationship to language…the extent to which ‘foreign’ languages from the socio-culturally sophisticated to the obscure, are now encoded in the material trappings of the everyday.” The unexpected twists and combinations that one encounters in was in the most familiar of formats, that of the book-bound text, familiarise us with what we often overlook; the multi-dimensionality and co-existence of languages that can open up multiple possibilities for expression in addition to data communication and exchange. was is a compilation of information where voices often oscillate between informational diversity and overload; moreover, the impact was has on the readers depends on their own idiosyncrasies and response to data. It is quite possible that was raises rather than answers questions about our position within a data-governed world and the need to develop skills so as to be able to navigate through it. Possibly what was brings forth does not limit itself to a mere ‘websurfing’ experience, as Thomas Hove has noted, but confronts us with the fluctuating curves of various physical as well as emotional and mental mood rhythms. 

The same effect is evident in Grant’s babel due to the colours she uses. The bright orange, purple, blue, pink and red word bubbles she resorts to do not simply enhance the visual motifs one can discern on the canvas, as noted earlier, but communicate to us the various rhythms implicated in the structure of the painting itself. Grant, in her online interview for ArtSlant, claims that “[she is] interested in a syntax that can reflect the complexity of the ideas involved. [She] love[s] works that are symphonic in the way there were imagined. When [she] made babel…it was in many ways a simple panorama but it was also symphonic in that it was based on Michael’s work was” (Schad). In this sense, her work is a compound structure in terms of its verbal and visual make up, consisting of various voices and stimuli that take it beyond the confines of singular artistry or familiar language schemes. The iconic ladders appearing in the middle of the painting and the skyscrapers squeezed in its bottom edges take on metaphorical significance as to the material density of the information surrounding us in addition to its ability to engage us intellectually. At the same time, these visual motifs serve as the artist’s own constraints in the process of conceptualising how Joyce’s was is going to be embedded into her own work. However, these constraints do not limit but set the basis for further action. Consequently, the motifs mentioned do not simply ensure a smooth transition from point to point in the painting, but set in motion different mechanisms of both seeing and perceiving information that bestow the painting endeavour with an energising and spontaneous feel.

Overall, the appreciation of Joyce’s and Grant’s works does not lie in the extraction of a particular meaning or in reaching a particular understanding but in recognising what Joyce had termed long ago in his book Of Two Minds as the contours of writing. He states:

In touch with the contours themselves, moving through them as a hand though the stream, channelling the flow like lights through a prism, the coextensivity of the text becomes the weave and reversal of water. The reader also learns to recognise the perceptual reversals, the ripples in which one contour impinges upon another, taking and surrendering the perceived continuity. (245) 

What Joyce puts forth here that could also be applied to Grant’s practice is a much more experiential attitude towards writing, seeing it as an energising and synthesising act that can capture diverse materials, create multiple patterns and evoke the fluidity of everyday reality through language. Joyce’s and Grant’s works highlight the emergence of a variable manner of reading stories and looking at paintings not for what they describe and represent but for the kind of experience they carry over. By gathering together various textual manifestations within the same book or canvas space, as Joyce’s novel and Grant’s painting suggest, we move from a state of completed action to a state of “senseless beauty [with] the emergence of as yet unrecognisable new ways of making sense” (Joyce, “New Stories for New Readers 178). The materials used are possibly the only things that are immediately recognisable and apparent but the text and words that are inscribed on them attempt something different, something not yet seen or expected to be seen but mostly felt and experienced.

By accepting oscillation and elusiveness as a viable practice when one moves between media and materials, as suggested by Joyce’s and Grant’s works, one comes to realise the multiple possibilities that open up for creative thinking and collaborative practice as well as for their re-invention and reconceptualisation. The novelty lies in the inter-mediated space, the interrelated network possibilities that are about to emerge, from the networks of spatial and temporal communication established between authors and artists, readers and viewers, words, codes, materials and media. Joyce’s and Grant’s conjoined textual experiments open up to sensations and experiences that both explore the confines of their compositional elements and move beyond them, thus familiarising us with what is yet unformed, the “othermindedness,” to use Joyce’s own term, of the network. 


[1] Alexandra Grant’s babel was presented from October 2012 to February 2013 in the Museum of Contemporary Art in Denver, U.S., as part of the exhibition Postscript: Writing after Conceptual Art curated by Nora Burnett Abrams and Andrea Andersson.

[2]  In S/Z (1970), Roland Barthes talks out the cutting up of “the tutor signifier into a series of brief, contiguous fragments, which we shall call lexias, since they are units of reading. This cutting up, admittedly will be arbitrary in the extreme;…The lexia will include sometimes a few words, sometimes several sentences;…it will suffice that the lexia be the best possible space in which we can observe meanings; its dimension empirically determined, estimated, will depend on the density of connotations, variable according to the moments of the text” (13, italics in original). This term is explored further by George P. Landow in his book Hypertext 2.0: The Convergence of Contemporary Critical Theory and Technology (1992) where Barthes’ reference to lexias is seen as “an attempt to move beyond print in the direction of hypertextuality [that] disturbs the text and the reading experience as we know them” (64-65). 

[3] The URL acronym stands for Uniform Resource Locator and is considered to be the standardised coded text used for the location of various internet or http pages by web browsers. 

  

Works Cited

Barthes, Roland. S/Z. Trans. Richard Miller. 1974. London: Blackwell, 1990. Print. 

Bolter, Jay David, and Richard Grusin. Remediation: Understanding New Media. Cambridge, MA: The MIT P, 2000. Print. 

Ciccoricco, Dave. “A Language of the Ordinary, or the eLEET?” Electronic Book Review. 21 Oct. 2008. Web. 10 July 2014. 

Galloway, Alexander R. “Networks.” Critical Terms for Media Studies. Ed. W.J.T. Mitchell and Mark B.N. Hansen. Chicago and London: The U of Chicago P, 2010. 280-296.  Print. 

Giovando, Chiara. “Wonderful Chaotic Shapes.” Artbound. 20 Jun. 2013. Web. 15 Jul. 2014. 

Grant, Alexandra. “A Way with Words.” Modern Edition. 2008. Web. 30 Jan. 2014. 

—. Babel. 2006. Museum of Contemporary Art. Los Angeles. 

—. “Re: Presentation.” Message to the author. 14 March 2012. E-mail. 

Hove, Thomas. “Review of was.Contemporary Fiction (Fall 2007): 221-22. Web. 30 Jan. 2014. 

Joyce, Michael. “New Stories for New Readers: Contour, Coherence and Constructive Hypertext.” Page to Screen: Taking Literacy into the Electronic Era. Ed. Ilana Snyder. London and New York: Routledge, 1998. 163-182. Print. 

—. Of Two Minds: Hypertext, Pedagogy and Poetics. Ann Arbor: U of Michigan P, 1996. Print. 

—. Othermindedness: The Emergence of Network Culture. Ann Arbor: U of Michigan P, 2001. Print. 

—. Personal Interview. June 2008. 

—. was: annals nomadique, a novel of internet. Tuscaloosa: FC2, 2007. 

Leonard, Philip. Literature After Globalization: Textuality, Technology and Nation State. London: Bloomsbury, 2013. Print. 

Marino, Mark. “Alexandra Grant & Michael Joyce: Wired Words.” WRT: Writer Response Theory. Writer Response Theory Blog, 25 May 2007. Web. 27 July 2009. 

Mitchell, W.J.T. Picture Theory. Chicago and London: The U of Chicago P, 1994. Print. 

Schad, Ed. “Alexandra Grant Rackroom.” ArtSlant. 2008. Web. 15 July 2014.